Design a specific oligonucleotide for synthesizing a single guide RNA (sgRNA) template according to desired cut site in your target sequence (~20 nucleotides length and must be followed by a protospacer adjacent motif (PAM) sequence of NGG).

A	B
Specific oligo	GGATCCTAATACGACTCACTATAGG[target sequence]GTTTTAGAGCTAGAA.
CRISPR R	AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
T7 F	GGATCCTAATACGACTCACTATAG
T7 R	AAAAAAGCACCGACTCGG

Combine following components for sgRNA template synthesis:

A	B
Component	Volume, μL
Specific oligo, 1 μM	2
CRISPR R, 1 μM	2
T7 F, 100 μM	2
T7 R, 100 μM	2
dNTP mix, 10 mM of each	2
10x buffer	10
High fidelity polymerase	1
Nuclease-free water	79
Total	100

Set the reaction with following program:

1. 95°C- 2 min
2. 30 cycles:

• 98°C - 30 sec
• 60°C - 30 sec
• 72°C - 30 sec

3. 72°C - 1 min

Check the structure of synthesized templates with agarose gel electrophoresis (single band for best results, but note that T7-sequences can lead to dimers forming).

Purify your sgRNA template with your system of choice. We use a column-based kit for gel extraction ( in the case of dimers or non-specific products ) and PCR purification ( in the case of a single band ).

Combine following components for T7 in vitro transcription of your sgRNA:

A	B
Component	Volume, μL
5x buffer	10
25x DTT	2
rNPT mix, 25 mM of each	2
sgRNA template (500 ng)	X
T7 RNA (150U/μL)	1 μL
Nuclease-free water	to get 50 µl total volume
Total	50

Incubate your reaction at 37°C for 2h 0m 0s. The incubation time can also be extended up to 16h 0m 0s (overnight) to obtain a higher sgRNA yield.

Purify your sgRNA template with your system of choice. We use a kit for the isolation of total RNA and microRNA.

Check the structure of synthesized sgRNA with agarose gel electrophoresis (the number of bands depends on the secondary sgRNA structure).

Combine equimolar amounts of sgRNAs for a targeted fragment in a single tube.

Add water to get 11µL

Heat and cool each sgRNAs to obtain pure monomers: 95°C for 0h 3m 0s , then cool to 95Room temperature for 0h 2m 0s

To form Cas9 RNPs, assemble the components in the table in a 1.5 ml Eppendorf DNA LoBind tube in the following order:

A	B
Reagent	Volume (per one cleavage reaction)
Cas9 5x buffer	3
Cas9	1
gRNA (50ng/μl ~ 1pmol/ul) in 11 μl water	11
Total	15

Mix thoroughly by flicking the tube

Form the RNPs by incubating the tube at 95Room temperature for 0h 30m 0s, then return the RNPs on ice until required (proceed to the 'Dephosphorylating genomic DNA' section during this time)

Transfer 1-10 μg (with 5 μg recommended) genomic DNA into 0.2 mL tubes.

ml thin-walled PCR tubes

Adjust to 24µLwith nuclease-free water

Mix thoroughly by flicking the tube avoiding unwanted shearing

Spin down briefly in a microfuge

Mix the Quick calf intestinal alkaline phosphatase (CIP) in the tube by pipetting up and down. Ensure that it is at 4Room temperature before use

Assemble the following components in a clean 0.2 ml thin-walled PCR tube:

A	B
Reagent	Volume
NEB CutSmart Buffer (10x)	4 µl
HMW genomic DNA (at ≥ 210 ng/µl)*	24-30 µl
Water	to get 34 µl total volume
Total	34 µl

Mix gently by flicking the tube , and spin down

Add 6µLof CIP to the tube

Mix gently by flicking the tube , and spin down

Using a thermal cycler, incubate at 37°C for 0h 30m 0s, 80°C for 0h 2m 0s then hold at 20Room temperature

Thaw the dATP tube, vortex to mix thoroughly, and place on ice

Dilute dATP to concentration 10millimolar (mM). In a 0.2 ml thin-walled PCR tube, make a 10millimolar (mM) dATP solution by adding 1µL of the 100millimolar (mM) dATP stock to 9µL of nuclease-free water. Vortex to mix, then spin down

Spin down and place the tube of Taq polymerase on ice

To the PCR tube containing 40µLdephosphorylated DNA sample, add:

A	B
Reagent	Volume
Dephosphorylated genomic DNA sample (Section 2)	40 µl
Cas9 RNPs (Section 1)	15 µl
10 mM dATP	1.5 µl
Taq polymerase	1 µl
Total	57.5 µl

Carefully mix the contents of the tube by gentle inversion, then spin down and place the tube in the thermal cycler

Using the thermal cycler, incubate at 37°C for 15-60 (0h 15m 0s are recommended) minutes, then 72°C for 0h 10m 0s and hold at 4°C or return to the tube to ice

Assemble the following at room temperature in a separate 1.5 ml Eppendorf DNA LoBind Tube, adding Adapter Mix (AMX) last, before you are ready to begin the ligation:

A	B
Reagent	Volume
Ligation Buffer (LNB)	25 µl
Nuclease-free water	5 µl
NEBNext Quick T4 DNA Ligase	12.5 µl
Adapter Mix (AMX)*	5 µl
Total	47.5 µl

• The Adapter Mix (AMX) must be added last and immediately before the ligation step

Mix by pipetting the above ligation mix thoroughly. Ligation Buffer (LNB) is very viscous, so the adapter ligation mix needs to be well-mixed

Add 20µL of the adapter ligation mix to the cleaved and dA-tailed sample. Mix gently by flicking the tube . Do not centrifuge the sample at this stage. Immediately after mixing, add the remainder (27.5µL) of the adapter ligation mix to the cleaved and dA-tailed sample, to yield a 105µL ligation mix

Mix gently by flicking the tube , and spin down

Incubate the reaction for 0h 20m 0s at 4Room temperature

Add 1 volume (105µL) of TE (8.0) to the ligation mix. Mix gently by flicking the tube

Add 0.3x volume (63µL) of AMPure XP Beads to the ligation sample. The volume of beads is calculated based on the volume after the addition of TE. Mix gently by inversion. If any sample ends up in the lid, spin down the tube very gently, keeping the beads suspended in a liquid

Incubate the sample for 0h 10m 0s at 4Room temperature

Spin down the sample and pellet on a magnet . Keep the tube on the magnet, and pipette off the supernatant

Wash the beads by adding either 250µL Long Fragment Buffer (LFB) or 250µL Short Fragment Buffer (SFB), depending on the size of your target molecule. Flick the beads to resuspend, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard

Repeat the previous step

Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow drying for 0h 0m 30s, but do not dry the pellet to the point of cracking

Remove the tube from the magnetic rack and resuspend the pellet in 13µL Elution Buffer (EB). Incubate for 0h 10m 0s at 4Room temperature

Pellet the beads on a magnet until the eluate is clear and colorless

Remove and retain 12µL of eluate which contains the DNA library in a clean 1.5 ml Eppendorf DNA LoBind tube

Prime a MinION flow cell as specified in Nanopore protocols, and finally load the library drop-wise through the Sample port (a detailed description including video documentation can be found here: Priming and loading the SpotON flow cell)